Chloroplast-encoded serotonin N-acetyltransferase in the red alga Pyropia yezoensis: gene transition to the nucleus from chloroplasts

نویسندگان

  • Yeong Byeon
  • Hyoung Yool Lee
  • Dong-Woog Choi
  • Kyoungwhan Back
چکیده

Melatonin biosynthesis involves the N-acetylation of arylalkylamines such as serotonin, which is catalysed by serotonin N-acetyltransferase (SNAT), the penultimate enzyme of melatonin biosynthesis in both animals and plants. Here, we report the functional characterization of a putative N-acetyltransferase gene in the chloroplast genome of the alga laver (Pyropia yezoensis, formerly known as Porphyra yezoensis) with homology to the rice SNAT gene. To confirm that the putative Pyropia yezoensis SNAT (PySNAT) gene encodes an SNAT, we cloned the full-length chloroplastidic PySNAT gene by PCR and purified the recombinant PySNAT protein from Escherichia coli. PySNAT was 174 aa and had 50% amino acid identity with cyanobacteria SNAT. Purified recombinant PySNAT showed a peak activity at 55 °C with a K m of 467 µM and V max of 28 nmol min-1 mg(-1) of protein. Unlike other plant SNATs, PySNAT localized to the cytoplasm due to a lack of N-terminal chloroplast transit peptides. Melatonin was present at 0.16ng g(-1) of fresh mass but increased during heat stress. Phylogenetic analysis of the sequence suggested that PySNAT has evolved from the cyanobacteria SNAT gene via endosymbiotic gene transfer. Additionally, the chloroplast transit peptides of plant SNATs were acquired 1500 million years ago, concurrent with the appearance of green algae.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

The First Symbiont-Free Genome Sequence of Marine Red Alga, Susabi-nori (Pyropia yezoensis)

Nori, a marine red alga, is one of the most profitable mariculture crops in the world. However, the biological properties of this macroalga are poorly understood at the molecular level. In this study, we determined the draft genome sequence of susabi-nori (Pyropia yezoensis) using next-generation sequencing platforms. For sequencing, thalli of P. yezoensis were washed to remove bacteria attache...

متن کامل

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

متن کامل

Codon optimization and cloning of bovine prochymosin gene for proper expression in tobacco plant

Bovine chymosin enzyme is one of the most commonly used enzymes in the dairy industry. The production of this enzyme from its natural source does not meet the needs of this huge industry. The production of recombinant bovine chymosin in plants can be a good alternative to native enzyme. Insertion and expression of foreign genes in plants can occur in the nucleus and chloroplast organelles. The ...

متن کامل

Isolation and regeneration of transiently transformed protoplasts from gametophytic blades of the marine red alga Porphyra yezoensis

Despite the recent progress of transient gene expression systems in a red alga Porphyra yezoensis by particle bombardment, a stable transformation system has yet to establish in any marine red macrophytes. One of the reasons of the difficulty in genetic transformation in red algae is the lack of systems to select and isolate transformed cells from gametophytic blades. Thus, toward the establish...

متن کامل

Characterization of an Eukaryotic PL-7 Alginate Lyase in the Marine Red Alga Pyropia yezoensis

BACKGROUND Alginate lyases belonging to polysaccharide lyase family-7 (PL-7) are the most well studied on their structures and functions among whole alginate lyases. However, all characterized PL-7 alginate lyases are from prokaryotic bacteria cells. Here we report the first identification of eukaryotic PL-7 alginate lyase from marine red alga Pyropia yezoensis. METHODS The cDNA encoding an a...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:

دوره 66  شماره 

صفحات  -

تاریخ انتشار 2015